Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2807777
End position: 2807821
Length: 45

DNA sequence
>NC_008261, from 2807777 to 2807821 (45 bp); Clostridium perfringens ATCC 13124 TCTTCTTTAATTTCATCTTTATTTATTTCATCTTTATTCATTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2806061-2808121	Sequence	CPF_2547 - triple tyrosine motif-containing protein (Protein is coded in complementary strand; from 2808121 to 2806061)