Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2741442
End position: 2741477
Length: 36

DNA sequence
>NC_008261, from 2741442 to 2741477 (36 bp); Clostridium perfringens ATCC 13124 ATTATTATAATTACTATTATTGTTATTATAATTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2740270-2741739	Sequence	CPF_2471 rho transcription termination factor Rho (Protein is coded in complementary strand; from 2741739 to 2740270)