Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1810645
End position: 1810680
Length: 36

DNA sequence
>NC_008261, from 1810645 to 1810680 (36 bp); Clostridium perfringens ATCC 13124 TTTTGAATATAATATTAAATATAATATTAAATATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1810518-1810709	Sequence	CPF_1594 - hypothetical protein (Protein is coded in complementary strand; from 1810709 to 1810518)