Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 3103356
End position: 3103385
Length: 30

DNA sequence
>NC_008261, from 3103356 to 3103385 (30 bp); Clostridium perfringens ATCC 13124 TTATCTTTATCCGTATCTTTATCCTTATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3102687-3104309	Sequence	CPF_2839 - hypothetical protein (Protein is coded in complementary strand; from 3104309 to 3102687)