Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2475954
End position: 2475983
Length: 30

DNA sequence
>NC_008261, from 2475954 to 2475983 (30 bp); Clostridium perfringens ATCC 13124 TTATTATTATAATTCTTATTATTTTTATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2475837-2475992	Sequence	CPF_2229 - hypothetical protein (Protein is coded in complementary strand; from 2475992 to 2475837)