Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 435855
End position: 435881
Length: 27

DNA sequence
>NC_008261, from 435855 to 435881 (27 bp); Clostridium perfringens ATCC 13124 GGAGAAGATGGAGAGGATGGAGAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 434536-437700	Sequence	CPF_0362 - type III restriction-modification system, res subunit