Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 3159647
End position: 3159673
Length: 27

DNA sequence
>NC_008261, from 3159647 to 3159673 (27 bp); Clostridium perfringens ATCC 13124 TTATACTTTTTATACTTCTTATAGTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3158107-3159843	Sequence	CPF_2888 cspA serine protease A (Protein is coded in complementary strand; from 3159843 to 3158107)