Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2512792
End position: 2512818
Length: 27

DNA sequence
>NC_008261, from 2512792 to 2512818 (27 bp); Clostridium perfringens ATCC 13124 TTCTTCCTCCTCTTCCTCTTCTTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2511938-2513038	Sequence	CPF_2264 rpoD RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 2513038 to 2511938)