Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2446507
End position: 2446533
Length: 27

DNA sequence
>NC_008261, from 2446507 to 2446533 (27 bp); Clostridium perfringens ATCC 13124 GGATTTTCTGGATTTTCAGGTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2446345-2449890	Sequence	CPF_2206 - bifunctional 2',3'-cyclic nucleotide 2'-phosphodiesterase/3'-nucleotidase precursor protein (Protein is coded in complementary strand; from 2449890 to 2446345)