Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2049992
End position: 2050018
Length: 27

DNA sequence
>NC_008261, from 2049992 to 2050018 (27 bp); Clostridium perfringens ATCC 13124 TATATATTAAATATATTATATATGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2049445-2050440	Sequence	CPF_1817 cax calcium/proton exchanger (Protein is coded in complementary strand; from 2050440 to 2049445)