Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1408018
End position: 1408044
Length: 27

DNA sequence
>NC_008261, from 1408018 to 1408044 (27 bp); Clostridium perfringens ATCC 13124 TAAAATTATCAAAATTATTTAAATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1407519-1408337	Sequence	CPF_1237 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 1408337 to 1407519)