Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1367634
End position: 1367660
Length: 27

DNA sequence
>NC_008261, from 1367634 to 1367660 (27 bp); Clostridium perfringens ATCC 13124 CCTTGAGGACCTTGAGGGCCTTGTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1367043-1368245	Sequence	CPF_1202 - triple helix repeat-containing collagen (Protein is coded in complementary strand; from 1368245 to 1367043)