Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2866476
End position: 2866500
Length: 25

DNA sequence
>NC_008261, from 2866476 to 2866500 (25 bp); Clostridium perfringens ATCC 13124 TCTTTTGTTTTCTCTTCTTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2866431-2867948	Sequence	CPF_2599 hsdM type I restriction-modification system, M subunit (Protein is coded in complementary strand; from 2867948 to 2866431)