Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2708317
End position: 2708341
Length: 25

DNA sequence
>NC_008261, from 2708317 to 2708341 (25 bp); Clostridium perfringens ATCC 13124 AATTTTATTTAAGTTAAATTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2707949-2708911	Sequence	CPF_2432 - hypothetical protein (Protein is coded in complementary strand; from 2708911 to 2707949)