Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2394985
End position: 2395009
Length: 25

DNA sequence
>NC_008261, from 2394985 to 2395009 (25 bp); Clostridium perfringens ATCC 13124 TTTTTTATTTTTTTCTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2394983-2395942	Sequence	CPF_2157 hslO Hsp33-like chaperonin (Protein is coded in complementary strand; from 2395942 to 2394983)