Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1766001
End position: 1766025
Length: 25

DNA sequence
>NC_008261, from 1766001 to 1766025 (25 bp); Clostridium perfringens ATCC 13124 TTTTTTATTTTATTTTTTCTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1765164-1766177	Sequence	CPF_1547 - LacI family transcriptional regulator (Protein is coded in complementary strand; from 1766177 to 1765164)