Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1286406
End position: 1286430
Length: 25

DNA sequence
>NC_008261, from 1286406 to 1286430 (25 bp); Clostridium perfringens ATCC 13124 AAGAAAATAAAAGTAATGAAGAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1281873-1286585	Sequence	CPF_1123 - cell wall-associated serine proteinase