Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 780652
End position: 780675
Length: 24

DNA sequence
>NC_008261, from 780652 to 780675 (24 bp); Clostridium perfringens ATCC 13124 TACTAATACAAATGCTAATATTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 779906-780706	Sequence	CPF_0650 - hypothetical protein (Protein is coded in complementary strand; from 780706 to 779906)