Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 61151
End position: 61174
Length: 24

DNA sequence
>NC_008261, from 61151 to 61174 (24 bp); Clostridium perfringens ATCC 13124 AATATTAATTTTAAGATTAATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 61090-61368	Sequence	CPF_0056 bofA sigma-K factor processing regulatory protein BofA