Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 578437
End position: 578460
Length: 24

DNA sequence
>NC_008261, from 578437 to 578460 (24 bp); Clostridium perfringens ATCC 13124 TTGAACTTGAAATGGAACTTGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 578221-579165	Sequence	CPF_0487 galU UTP-glucose-1-phosphate uridylyltransferase