Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 3101155
End position: 3101178
Length: 24

DNA sequence
>NC_008261, from 3101155 to 3101178 (24 bp); Clostridium perfringens ATCC 13124 TATTAATATAAATATTGATATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3101093-3101863	Sequence	CPF_2837 lgt prolipoprotein diacylglyceryl transferase (Protein is coded in complementary strand; from 3101863 to 3101093)