Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2844070
End position: 2844093
Length: 24

DNA sequence
>NC_008261, from 2844070 to 2844093 (24 bp); Clostridium perfringens ATCC 13124 TATCATTAGCATTATTATTATCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2843892-2844392	Sequence	CPF_2579 - signal peptidase I (Protein is coded in complementary strand; from 2844392 to 2843892)