Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2811862
End position: 2811885
Length: 24

DNA sequence
>NC_008261, from 2811862 to 2811885 (24 bp); Clostridium perfringens ATCC 13124 TTTTCAAATTTTCAACTTTTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2810934-2811902	Sequence	CPF_2551 - oligopeptide/dipeptide ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 2811902 to 2810934)