Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2648378
End position: 2648401
Length: 24

DNA sequence
>NC_008261, from 2648378 to 2648401 (24 bp); Clostridium perfringens ATCC 13124 AAAAAGAATAAGAAATAGAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2647093-2648427	Sequence	CPF_2376 dacF D-alanyl-D-alanine carboxypeptidase