Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2640359
End position: 2640382
Length: 24

DNA sequence
>NC_008261, from 2640359 to 2640382 (24 bp); Clostridium perfringens ATCC 13124 ATTTTAATTTTCCTTTTAAGTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2639725-2641080	Sequence	CPF_2370 rumA 23S rRNA (uracil-5-)-methyltransferase RumA (Protein is coded in complementary strand; from 2641080 to 2639725)