Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2622938
End position: 2622961
Length: 24

DNA sequence
>NC_008261, from 2622938 to 2622961 (24 bp); Clostridium perfringens ATCC 13124 ATTTATATTTATATCTATATTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2622885-2623280	Sequence	CPF_2357 - hypothetical protein (Protein is coded in complementary strand; from 2623280 to 2622885)