Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2496580
End position: 2496603
Length: 24

DNA sequence
>NC_008261, from 2496580 to 2496603 (24 bp); Clostridium perfringens ATCC 13124 CCATATCCATATCCTTATGCATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2496366-2496965	Sequence	CPF_2249 coaE dephospho-CoA kinase (Protein is coded in complementary strand; from 2496965 to 2496366)