Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 2350194
End position: 2350217
Length: 24

DNA sequence
>NC_008261, from 2350194 to 2350217 (24 bp); Clostridium perfringens ATCC 13124 TTTTTTTTATTTTTTTATCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2349920-2350348	Sequence	CPF_2118 - cell division protein FtsL (Protein is coded in complementary strand; from 2350348 to 2349920)