Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1927312
End position: 1927335
Length: 24

DNA sequence
>NC_008261, from 1927312 to 1927335 (24 bp); Clostridium perfringens ATCC 13124 ATTTTTTTATTTTCTTATTATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1927319-1928347	Sequence	CPF_1705 - rhomboid family protein (Protein is coded in complementary strand; from 1928347 to 1927319)