Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1860916
End position: 1860939
Length: 24

DNA sequence
>NC_008261, from 1860916 to 1860939 (24 bp); Clostridium perfringens ATCC 13124 TTTCTTTTTCATTTTCTTTTTCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1859334-1861046	Sequence	CPF_1645 lonB ATP-dependent protease LonB (Protein is coded in complementary strand; from 1861046 to 1859334)