Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1622947
End position: 1622970
Length: 24

DNA sequence
>NC_008261, from 1622947 to 1622970 (24 bp); Clostridium perfringens ATCC 13124 ACAGCAACAGCAACTGCAACAGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1622926-1623927	Sequence	CPF_1440 - hypothetical protein (Protein is coded in complementary strand; from 1623927 to 1622926)