Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 134655
End position: 134678
Length: 24

DNA sequence
>NC_008261, from 134655 to 134678 (24 bp); Clostridium perfringens ATCC 13124 GAAATTGAATTTGAAAATGAAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 133611-134861	Sequence	CPF_0113 - hypothetical protein (Protein is coded in complementary strand; from 134861 to 133611)