Sequence retrieval

Genome: Clostridium perfringens ATCC 13124
Start position: 1089342
End position: 1089365
Length: 24

DNA sequence
>NC_008261, from 1089342 to 1089365 (24 bp); Clostridium perfringens ATCC 13124 TTATAGTTTTATATTTTAATAGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1089077-1090141	Sequence	CPF_0926 - phage integrase site specific recombinase (Protein is coded in complementary strand; from 1090141 to 1089077)