Sequence retrieval

Genome: Francisella tularensis subsp. tularensis FSC 198
Start position: 735965
End position: 736000
Length: 36

DNA sequence
>NC_008245, from 735965 to 736000 (36 bp); Francisella tularensis subsp. tularensis FSC 198 ATGATCAAAACAATGATCAAAATAATGATCAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 734003-736285	Sequence	FTF0715 - chitinase family 18 protein