Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 4594253
End position: 4594312
Length: 60

DNA sequence
>NC_008228, from 4594253 to 4594312 (60 bp); Pseudoalteromonas atlantica T6c GCTATATTGAGTGAGTTAAGACTATATTGGGTGCGTTAAGACTTTATTGAGTGCATTAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 4594309-4595130	Sequence	Patl_3809 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 4595130 to 4594309)