Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 4592409
End position: 4592462
Length: 54

DNA sequence
>NC_008228, from 4592409 to 4592462 (54 bp); Pseudoalteromonas atlantica T6c ACCTTGTTGAGGTTGATGACCTTTTTGGGGTTGAAGACTCTTTTGAGGTTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4591867-4592907	Sequence	Patl_3807 - phage integrase (Protein is coded in complementary strand; from 4592907 to 4591867)