Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 3300833
End position: 3300883
Length: 51

DNA sequence
>NC_008228, from 3300833 to 3300883 (51 bp); Pseudoalteromonas atlantica T6c CGAGCTCTTTACATCGCCCGGCTCTTTACATCGCCCGGCCCTTTACATCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3300876-3301226	Sequence	Patl_2709 - hypothetical protein (Protein is coded in complementary strand; from 3301226 to 3300876)