Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 2759494
End position: 2759544
Length: 51

DNA sequence
>NC_008228, from 2759494 to 2759544 (51 bp); Pseudoalteromonas atlantica T6c TTATTTTTTTTACATCTTGGTTTTTATTACATCTTAGTTTTTATTACATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2759545-2762418	Sequence	Patl_2269 - UvrD/REP helicase (Protein is coded in complementary strand; from 2762418 to 2759545)