Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 3362257
End position: 3362304
Length: 48

DNA sequence
>NC_008228, from 3362257 to 3362304 (48 bp); Pseudoalteromonas atlantica T6c TCGCTTATTCTCTTATTCTCTTATTCTCTTATTCTCTTATTCTCTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3362305-3362994	Sequence	Patl_2769 - hypothetical protein (Protein is coded in complementary strand; from 3362994 to 3362305)