Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 4600075
End position: 4600119
Length: 45

DNA sequence
>NC_008228, from 4600075 to 4600119 (45 bp); Pseudoalteromonas atlantica T6c CGTCTTTTTGTCTGCTCTCTTTTTGTCTACTCTCTTTTTGTCTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4600037-4603918	Sequence	Patl_3814 - 5-oxoprolinase (Protein is coded in complementary strand; from 4603918 to 4600037)