Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 4405938
End position: 4405982
Length: 45

DNA sequence
>NC_008228, from 4405938 to 4405982 (45 bp); Pseudoalteromonas atlantica T6c GGTGTCCGTGATGAGAGTGACCGTGATGAGAGTGTCCATGGTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4405076-4406230	Sequence	Patl_3652 - cation diffusion facilitator family transporter (Protein is coded in complementary strand; from 4406230 to 4405076)