Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 3306378
End position: 3306422
Length: 45

DNA sequence
>NC_008228, from 3306378 to 3306422 (45 bp); Pseudoalteromonas atlantica T6c AGCGCTGTTTTGGCTAGCGCCTTCTTGGCTGGCGCTCTTTTCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3305413-3306477	Sequence	Patl_2712 - hypothetical protein (Protein is coded in complementary strand; from 3306477 to 3305413)