Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 3162289
End position: 3162333
Length: 45

DNA sequence
>NC_008228, from 3162289 to 3162333 (45 bp); Pseudoalteromonas atlantica T6c ACTTTTTTATCAACGACGTTTTTATTAACGACTTTTTTGTCAGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3161674-3162447	Sequence	Patl_2600 - hypothetical protein (Protein is coded in complementary strand; from 3162447 to 3161674)