Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 3048769
End position: 3048813
Length: 45

DNA sequence
>NC_008228, from 3048769 to 3048813 (45 bp); Pseudoalteromonas atlantica T6c TCGTTCATTGAGGAAGCGTTTATTAAGGAAGCGTTCATTGACGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3048142-3048807	Sequence	Patl_2512 - hypothetical protein (Protein is coded in complementary strand; from 3048807 to 3048142)
ORF... 3048804-3049850	Sequence	Patl_2513 - hypothetical protein (Protein is coded in complementary strand; from 3049850 to 3048804)