Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 1841210
End position: 1841254
Length: 45

DNA sequence
>NC_008228, from 1841210 to 1841254 (45 bp); Pseudoalteromonas atlantica T6c TTGTGGGGCAATACTTTGTGGGGCAATACTTTGTGGGGCAATACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1840935-1842635	Sequence	Patl_1535 - sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 1842635 to 1840935)