Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 3400114
End position: 3400152
Length: 39

DNA sequence
>NC_008228, from 3400114 to 3400152 (39 bp); Pseudoalteromonas atlantica T6c TTATCTACTACTCTTATCCACGACTCTTATTTACTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3399729-3400115	Sequence	Patl_2799 - hypothetical protein (Protein is coded in complementary strand; from 3400115 to 3399729)