Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 3365469
End position: 3365504
Length: 36

DNA sequence
>NC_008228, from 3365469 to 3365504 (36 bp); Pseudoalteromonas atlantica T6c TGTATTAAGTGGCGTATGAAGTGGCGTATTAAGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3364846-3365520	Sequence	Patl_2772 - nitroreductase (Protein is coded in complementary strand; from 3365520 to 3364846)