Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 2835674
End position: 2835709
Length: 36

DNA sequence
>NC_008228, from 2835674 to 2835709 (36 bp); Pseudoalteromonas atlantica T6c GTTTTGCCTTAGGTTTTGCTTTTGGCTTTGTCTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2835661-2836941	Sequence	Patl_2330 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 2836941 to 2835661)