Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 1718357
End position: 1718392
Length: 36

DNA sequence
>NC_008228, from 1718357 to 1718392 (36 bp); Pseudoalteromonas atlantica T6c TGTTTGTTTCATTGTTTTTTTCATCGCTTGTTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1716663-1718393	Sequence	Patl_1429 - hypothetical protein (Protein is coded in complementary strand; from 1718393 to 1716663)