Sequence retrieval

Genome: Pseudoalteromonas atlantica T6c
Start position: 5173088
End position: 5173117
Length: 30

DNA sequence
>NC_008228, from 5173088 to 5173117 (30 bp); Pseudoalteromonas atlantica T6c AAAGATTTCCTAAGATTTCCATAGATTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 5172862-5173110	Sequence	Patl_4300 - F0F1 ATP synthase subunit C (Protein is coded in complementary strand; from 5173110 to 5172862)